At Speedy Template, You can download Dotplot . There are a few ways to find the forms or templates you need. You can choose forms in your state, use search feature to find the related forms. At the end of each page, there is "Download" button for the forms you are looking form if the forms don't display properly on the page, the Word or Excel or PDF files should give you a better reivew of the page.
Enter sequences in cells B2 and B3
To analyze sequences longer than 30 bases, copy formulas in each of the four plots across and down.
Seq 1 (horiz) acgtggccatatatcgccacgt
Seq 2 (vert)acgtggccatatatcgccacgt
Window size3Current maximum window size is 23. To increase this parameter, make identity matrix (on second sheet) the desired max window size.
Mismatch limit
0
Dot is black if window centered at that cell contains no more than this number of mismatches.
Is DNATRUEEnter TRUE if sequences are DNA, and FALSE otherwise.